Twist Bioscience Corporation (NASDAQ:TWST) Q3 2022 Earnings Conference Call August 5, 2022 8:00 AM ET Company Participants Angela Bitting - Chief ESG Officer & SVP, Corporate Affairs Dr. Emily Leproust - Co-Founder, Chairman, President & CEO Jim Thorburn - CFO Conference Call Participants Matthew Sykes - Goldman Sachs Vijay Kumar - Evercore ISI Jake Putman - Barclays Puneet Souda - SVB Securities Max Smock - William Blair Catherine Schulte - Baird Steven Mah - Cowen Operator Welcome to the Twist Bioscience’ ...

G A G A G A L C T A ATCGATTS ICGAIA TGAGATCI W Fiscal 2022 3Q Financial Results AGATCTAG CGAT GATCOSTAGGTACAO ATGAGA TCATGAGATCCAGGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs; Chief ESG Officer Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking stat ...

| --- | --- | --- | --- | --- | |---------------------------------------------------------------------------------------------------------|-------|-------|-------|-------| | | | | | | | | | | | | | | | | | | | LOREM IPSUM | | | | | | DOLOR SIT AMET CONSECTETUR Twist Advances in NGS Applications Emily Leproust, PhD CEO and Co-Founder | | | | | | | | | | | 1 Legal Disclaimers This presentation contains forward-looking statements. In particular, statements regarding Twist Bioscience Corporation's ("Twist," "we ...

GAGAIICTA ATCGATTS ICGAIA TGAGATCI W BIOSCIENCE Fiscal 2022 2Q Financial Results AGATCTAG CGAT GATCC CTACACACATGAGA TCATGAGATCCGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking statements. All statements ...

Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended March 31, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...

GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future FEBRUARY 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of mana ...

Fiscal 2022 1Q Financial Results AGATCTAGCGA TAGGTACAC T C A T G A G A T C A T G C T G A T G C T G Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | T W I S T B I O S C I E N C E Legal Disclaimers This presentation contains forward-looking statements. All statements other than statements of histo ...

Revenue Growth - Revenue increased by 49% to $42.0 million for the three months ended December 31, 2021, compared to $28.2 million for the same period in 2020[120]. - Synthetic gene revenue grew to $13.5 million, up from $9.7 million in the previous quarter, driven by an increase in the customer base and new product launches[106]. - Antibody discovery revenue rose to $4.8 million from $2.6 million in the previous quarter, attributed to growth from the recent Abveris acquisition[106]. - The Americas accounted for 54% of total revenues, while EMEA and APAC contributed 37% and 9%, respectively[116]. Expenses and Losses - Net loss attributable to common stockholders was $45.6 million for the three months ended December 31, 2021, compared to a net loss of $32.9 million for the same period in 2020[112]. - Research and development expenses increased by 62% to $22.6 million, up from $14.0 million in the same quarter of 2020, primarily due to increased headcount and outside services[122]. - Selling, general and administrative expenses increased to $51.1 million from $35.8 million in the previous quarter, driven by higher payroll and professional services costs[106]. - Selling, general and administrative expenses increased to $51.1 million in Q4 2021 from $28.8 million in Q4 2020, a 77% increase, primarily due to payroll expenses rising by $15.6 million[123]. Cash Flow and Investments - Net cash used in operating activities was $(46.7) million in Q4 2021, compared to $(24.9) million in Q4 2020, reflecting a worsening cash flow situation[139][140]. - Investing activities in Q4 2021 resulted in a net cash outflow of $(226.6) million, significantly higher than $(45.9) million in Q4 2020, indicating increased investment activity[141][142]. - Financing activities led to a net cash outflow of $(1.0) million in Q4 2021, contrasting sharply with a net inflow of $326.9 million in Q4 2020, highlighting a shift in financing strategy[143][144]. - As of December 31, 2021, the company had $191.6 million in cash and cash equivalents, $110.2 million in short-term investments, and $106.8 million in long-term investments, indicating a strong liquidity position[129]. - The company had $69.7 million in commitments for capital expenditures as of December 31, 2021, reflecting ongoing investment in growth initiatives[137]. Operational Expansion - The company shipped approximately 125,000 genes in the three months ended December 31, 2021, a 49% increase from approximately 84,000 genes in the same period of 2020[120]. - The company has expanded its manufacturing operations with a 12-year lease for approximately 111,000 square feet and an additional 101,000 square feet in the Portland area[109]. - The company entered into a 7-year operating lease for office space in South San Francisco, with total future minimum lease payments of $13.1 million, indicating expansion plans[148]. Tax and Interest - The income tax benefit recorded in Q4 2021 was $10.4 million, a significant increase from an expense of $(0.05) million in Q4 2020, representing a 227% change[126]. - Interest income rose to $0.2 million in Q4 2021, a 15% increase from $0.1 million in Q4 2020, while interest expense decreased by 78% to $(0.03) million[125]. Financial Position and Risks - The company had cash, cash equivalents, and marketable securities totaling $408.7 million as of December 31, 2021, down from $477.9 million as of September 30, 2021[164]. - The company is exposed to interest rate risk, with a hypothetical 10% relative change in interest rates not expected to materially impact financial statements[165]. - Foreign currency transactions primarily involve the Euro, Chinese Yuan, and British Pound, exposing the company to foreign exchange risk[166]. - The company does not use derivative financial instruments for speculative trading purposes, minimizing counterparty risk through creditworthy banks[167]. Goodwill and Intangible Assets - Goodwill is tested for impairment annually, with significant judgment required to assess fair value against carrying value[162]. - Intangible assets from business acquisitions include goodwill and development technology, with critical estimates based on projected revenues and discount rates[160]. Revenue Recognition - Biopharma revenue primarily consists of research and development agreements, with contract assets of $4.4 million and contract liabilities of $0.9 million as of December 31, 2021[157]. - Revenue is recognized based on the timing of development activities, with no revenue recognized from performance obligations satisfied in previous periods[157]. - The company recognizes revenue from functional license agreements when the license is transferred to the customer, allowing them to use and benefit from the license[156]. Stock-Based Compensation - Stock-based compensation includes performance-based stock units (PSUs) granted to executive officers and senior employees, with fair value calculated using the Black-Scholes method[159].

Financial Data and Key Metrics Changes - The company reported record revenue of $42 million for Q1 2022, representing a sequential growth of 11% and a year-over-year growth of 49% [39] - Orders for the quarter were $49.6 million, a sequential increase of 10% and a year-over-year growth of 48% [39] - Gross margin for Q1 was 35.6%, slightly up from 35.5% in Q1 2021 [49] - The company ended the quarter with cash and investments of approximately $409 million [40] Business Line Data and Key Metrics Changes - SynBio revenue reached $18 million, up from $13.9 million in the same quarter of fiscal 2021, with orders at $22.2 million, a 40% increase year-over-year [46][43] - NGS revenue was $19.2 million, reflecting a 23% growth year-over-year, with orders at $21.8 million, a 28% increase year-over-year [45][41] - Biopharma revenue was approximately $4.8 million, including one month of contribution from the Abveris acquisition [46] Market Data and Key Metrics Changes - Healthcare revenue was $21 million, up from $16 million in Q1 2021; Industrial Chemicals revenue was $12.5 million, compared to $7.1 million in the same period [47] - EMEA region revenue was $15.4 million, significantly up from $9.1 million in Q1 2021, while APAC revenue reached $4 million, up from $1.8 million [48] Company Strategy and Development Direction - The company plans to continue expanding its customer base in synthetic biology and aims to bring the Factory of the Future online to reduce turnaround times and launch new products [61] - In NGS, the focus is on growing the market for liquid biopsy and MRD, with expectations of significant revenue expansion as these products reach commercialization [62] - The biopharma segment aims to leverage the integration of Abveris to enhance revenue through partnerships and internal pipeline advancements [63] Management's Comments on Operating Environment and Future Outlook - Management expressed optimism about the growth opportunities in NGS, particularly in liquid biopsy and MRD, despite short-term impacts from the Omicron variant [39][86] - The company anticipates a strong second half of fiscal 2022, driven by increased customer adoption and product launches [86] Other Important Information - The company has increased its revenue guidance for fiscal 2022 to a range of $189 million to $198 million, up from the previous guidance of $183 million to $193 million [54] - The gross margin guidance remains at 35% to 37%, reflecting ongoing costs associated with the Portland brand [56] Q&A Session Summary Question: Can you discuss the path forward for the Enzymatic Synthesis platform? - The company plans to develop its own hardware for Enzymatic Synthesis, particularly for enterprise data storage, while remaining open to partnerships for other markets [67][69] Question: What is the pricing variation for NGS products, especially for liquid biopsy? - Pricing varies based on the number of probes in a panel and the volume of samples ordered, with the company targeting to capture 5% to 10% of the liquid biopsy market [70][71] Question: What drove the strong growth in the EMEA region, and is it sustainable? - Growth in EMEA is attributed to investments in the commercial organization and strong demand across key countries, with expectations for continued growth [75] Question: Were the production challenges from the last quarter resolved? - Production issues were resolved, and the company shipped a record 125,000 genes, indicating strong demand in SynBio [82] Question: Why is the NGS guidance flat despite strong momentum? - The flat guidance reflects near-term conservatism, but the company expects significant growth in the second half of the year driven by customer adoption [86] Question: How has the nature of conversations in biopharma changed? - The company has gained a strong reputation, making it easier to engage with larger, more conservative companies compared to a few years ago [101]

Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-K (Mark One) ☒ ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the fiscal year ended September 30, 2021 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-205888 (Sta ...