Workflow
Twist Bioscience(TWST)
icon
Search documents
Twist Bioscience (TWST) Presents at the AGBT Conference 2022 - Slideshow
2022-06-18 15:33
| --- | --- | --- | --- | --- | |---------------------------------------------------------------------------------------------------------|-------|-------|-------|-------| | | | | | | | | | | | | | | | | | | | LOREM IPSUM | | | | | | DOLOR SIT AMET CONSECTETUR Twist Advances in NGS Applications Emily Leproust, PhD CEO and Co-Founder | | | | | | | | | | | 1 Legal Disclaimers This presentation contains forward-looking statements. In particular, statements regarding Twist Bioscience Corporation's ("Twist," "we ...
Twist Bioscience(TWST) - 2022 Q2 - Earnings Call Presentation
2022-05-06 06:58
GAGAIICTA ATCGATTS ICGAIA TGAGATCI W BIOSCIENCE Fiscal 2022 2Q Financial Results AGATCTAG CGAT GATCC CTACACACATGAGA TCATGAGATCCGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking statements. All statements ...
Twist Bioscience Corp (TWST) Investor Presentation - Slideshow
2022-03-07 18:26
GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future FEBRUARY 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of mana ...
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Presentation
2022-02-17 20:57
Fiscal 2022 1Q Financial Results AGATCTAGCGA TAGGTACAC T C A T G A G A T C A T G C T G A T G C T G Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | T W I S T B I O S C I E N C E Legal Disclaimers This presentation contains forward-looking statements. All statements other than statements of histo ...
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Transcript
2022-02-04 19:45
Twist Bioscience Corporation (NASDAQ:TWST) Q1 2022 Earnings Conference Call February 4, 2022 8:00 AM ET Company Participants Angela Bitting – Senior Vice President-Corporate Affairs and Chief ESG Officer Emily Leproust – Chief Executive Officer and Co-Founder Jim Thorburn – Chief Financial Officer Conference Call Participants Catherine Schulte – Baird Casey Rene Woodring – J. P. Morgan Puneet Souda – SVB Leerink Luke Sergott – Barclays Matt Sykes – Goldman Sachs Vijay Kumar – Evercore ISI Matt Larew – Willi ...
Twist Bioscience(TWST) - 2021 Q4 - Earnings Call Presentation
2021-11-22 14:20
l - W ● BIOSCIENCE . Fiscal 2021 4Q and Year-End Financial Results November 22, 2021 Agenda | --- | --- | --- | |----------------------------------------|-------|-------| | | | | | | | | | Welcome Angela Bitting | | | | SVP, Corporate Affairs | | | | Quarterly and Annual Highlights | | | | Emily Leproust | | | | Chief Executive Officer | | | | Financial and Operational Performance | | | | Jim Thorburn | | | | Chief Financial Officer | | | | Pipeline & Milestones | | | | Emily Leproust Chief Executive Office ...
Twist Bioscience(TWST) - 2021 Q3 - Earnings Call Presentation
2021-08-09 15:46
| W ● BIOSCIENCE . ● Fiscal 2021 3Q Financial Results August 6, 2021 Agenda | --- | --- | --- | |----------------------------------------|-------|-------| | | | | | | | | | Welcome Angela Bitting | | | | SVP, Corporate Affairs | | | | Quarterly Highlights | | | | Emily Leproust | | | | Chief Executive Officer | | | | Financial and Operational Performance | | | | Jim Thorburn | | | | Chief Financial Officer | | | | Pipeline & Milestones | | | | Emily Leproust Chief Executive Officer | | | Q&A Session 2 | TWI ...
Twist Bioscience(TWST) - 2021 Q3 - Earnings Call Transcript
2021-08-06 19:13
Twist Bioscience Corp. (NASDAQ:TWST) Q3 2021 Earnings Conference Call August 6, 2021 8:00 AM ET Company Participants Emily Leproust – CEO and Co-Founder Angela Bitting – SVP of Corporate Affairs Jim Thorburn – CFO Conference Call Participants Doug Schenkel – Cowen Matt Sykes – Goldman Sachs Catherine Schulte – Baird Vijay Kumar – Evercore ISI Matt Larew – William Blair (ph) Tycho Peterson – JP Morgan Operator Welcome to Twist Biosciences, Fiscal 2021, Third Quarter Financial results conference call. At this ...
Twist Bioscience(TWST) - 2021 Q2 - Earnings Call Transcript
2021-05-08 00:38
Twist Bioscience Corporation (NASDAQ:TWST) Q2 2021 Results Conference Call May 6, 2021 4:30 PM ET Company Participants Jim Thorburn - Chief Financial Officer Dr. Emily Leproust - CEO and Co-Founder Conference Call Participants Eleni Apostolatos - Cowen Thomas Peterson - Bard Casey Woodring - JPMorgan Vijay Kumar - Evercore Puneet Souda - SVB Leerink Operator Welcome to Twist Bioscience Fiscal 2021 Second Quarter Financial Results Conference Call. At this time, all participants are in a listen-only. After th ...
Twist Bioscience(TWST) - 2021 Q2 - Earnings Call Presentation
2021-05-07 20:02
l W ● BIOSCIENCE . Fiscal 2021 2Q Financial Results May 6, 2021 Agenda | --- | --- | --- | --- | --- | |---------------------------------------|-------|-------|-------|-------| | | | | | | | | | | | | | Welcome | | | | | | | | | | | | Jim Thorburn Chief Financial Officer | | | | | | Quarterly Highlights | | | | | | Emily Leproust | | | | | | Chief Executive Officer | | | | | | Financial and Operational Performance | | | | | | Jim Thorburn | | | | | | Chief Financial Officer | | | | | | Pipeline & Milestones ...