Twist Bioscience(TWST)

Search documents
Twist Bioscience(TWST) - 2023 Q3 - Earnings Call Presentation
2023-08-04 12:05
ACTACCATCAT Financial Results . BIOSCIENCE Welcome Angela Bitting SVP, Corporate Affairs; Chief ESG Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Q&A Session T This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forward-looking statements reflecting the current beliefs and expectations of management made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act o ...
Twist Bioscience(TWST) - 2023 Q2 - Quarterly Report
2023-05-07 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended March 31, 2023 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...
Twist Bioscience(TWST) - 2023 Q2 - Earnings Call Transcript
2023-05-05 16:31
Twist Bioscience Corporation (NASDAQ:TWST) Q2 2023 Earnings Conference Call May 5, 2023 8:00 AM ET Company Participants Angela Bitting - SVP, Corporate Affairs and ESG Officer Emily Leproust - CEO and Co-Founder James Thorburn - CFO Conference Call Participants Vijay Kumar - Evercore ISI Matt Larew - William Blair Steven Mah - Cowen Sung-Ji Nam - Scotiabank Luke Sergott - Barclays Puneet Souda - SVB Securities Tom Peterson - Baird Rachel Vatnsdal - JPMorgan Operator Good morning, ladies and gentlemen, and w ...
Twist Bioscience(TWST) - 2023 Q1 - Quarterly Report
2023-02-06 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended December 31, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 (State or other jurisdict ...
Twist Bioscience(TWST) - 2023 Q1 - Earnings Call Transcript
2023-02-03 19:10
Twist Bioscience Corp (NASDAQ:TWST) Q1 2023 Earnings Conference Call February 3, 2023 8:00 AM ET Company Participants Angela Bitting - Chief ESG Officer & SVP, Corporate Affairs Emily Leproust - Co-Founder, Chairman & CEO James Thorburn - CFO Conference Call Participants Poon Mah - Cowen and Company Luke Sergott - Barclays Bank Matthew Larew - William Blair & Company Vijay Kumar - Evercore ISI Puneet Souda - SVB Securities Noah Burhance - JPMorgan Chase & Co. Operator Welcome to Twist Bioscience's Fiscal 20 ...
Twist Bioscience(TWST) - 2022 Q4 - Annual Report
2022-11-27 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-K (Mark One) ☒ ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the fiscal year ended September 30, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) (State or other jurisdi ...
Twist Bioscience(TWST) - 2022 Q4 - Earnings Call Transcript
2022-11-18 15:18
Twist Bioscience Corporation (NASDAQ:TWST) Q4 2022 Earnings Conference Call November 18, 2022 8:00 AM ET Company Participants Angela Bitting - Senior Vice President, Corporate Affairs & Chief ESG Officer Emily Leproust - Chief Executive Officer & Co-Founder Jim Thorburn - Chief Financial Officer Conference Call Participants Steven Mah - Cowen Catherine Schulte - RW. Baird Matthew Sykes - Goldman Sachs Luke Sergott - Barclays Vijay Kumar - Evercore ISI Puneet Souda - SVB Securities Rachel Vatnsdal - JPMor ...
Twist Bioscience(TWST) - 2022 Q4 - Earnings Call Presentation
2022-11-18 13:51
Fiscal 2022 4Q and Year-End Financial Results 1 Agenda Welcome Angela Bitting SVP, Corporate Affairs; Chief ESG Officer Quarterly and Annual Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | T W I S T B I O S C I E N C E Legal Disclaimers This presentation contains forward-looking statements. All statements other than statements of historical facts contained ...
Twist Bioscience (TWST) Investor Presentation - Slideshow
2022-08-12 19:44
GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future AUGUST 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of manage ...
Twist Bioscience(TWST) - 2022 Q3 - Quarterly Report
2022-08-07 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended June 30, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...