Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended December 31, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 (State or other jurisdict ...

Twist Bioscience Corp (NASDAQ:TWST) Q1 2023 Earnings Conference Call February 3, 2023 8:00 AM ET Company Participants Angela Bitting - Chief ESG Officer & SVP, Corporate Affairs Emily Leproust - Co-Founder, Chairman & CEO James Thorburn - CFO Conference Call Participants Poon Mah - Cowen and Company Luke Sergott - Barclays Bank Matthew Larew - William Blair & Company Vijay Kumar - Evercore ISI Puneet Souda - SVB Securities Noah Burhance - JPMorgan Chase & Co. Operator Welcome to Twist Bioscience's Fiscal 20 ...

Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-K (Mark One) ☒ ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the fiscal year ended September 30, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) (State or other jurisdi ...

Twist Bioscience Corporation (NASDAQ:TWST) Q4 2022 Earnings Conference Call November 18, 2022 8:00 AM ET Company Participants Angela Bitting - Senior Vice President, Corporate Affairs & Chief ESG Officer Emily Leproust - Chief Executive Officer & Co-Founder Jim Thorburn - Chief Financial Officer Conference Call Participants Steven Mah - Cowen Catherine Schulte - RW. Baird Matthew Sykes - Goldman Sachs Luke Sergott - Barclays Vijay Kumar - Evercore ISI Puneet Souda - SVB Securities Rachel Vatnsdal - JPMor ...

Financial Performance - Twist Bioscience reported record revenue of $2036 million for fiscal year 2022, a 54% increase year-over-year (YoY)[5] - Orders for fiscal year 2022 reached $226 million, a 42% increase YoY[5] - Q4 2022 revenue was $573 million and orders were $621 million[5] - Gross margin for fiscal year 2022 was 41%, and 449% for Q4 2022[35] - Net loss for fiscal year 2022 was $2348 million[35] Business Segments - Synthetic Biology revenue for fiscal year 2022 was $800 million with $907 million in orders[12] - NGS revenue for fiscal year 2022 was $993 million with $1041 million in orders[14] - Biopharma revenue for fiscal year 2022 was $242 million with $316 million in orders[19] - In fiscal year 2022, Twist Bioscience shipped 558000 genes[12] Customer Growth and Partnerships - Customer count increased from approximately 1700 in FY21 to approximately 2100 in Q4 FY22 and approximately 2900 in FY21 to approximately 3300 in FY22[9] - Twist Biopharma has 59 partners, 50 active programs, and 83 completed programs[17] - Twist Biopharma entered into 6 new partnerships in Q4 2022[19] Future Outlook - Expected revenue for fiscal year 2023 is projected to be between $261 million and $269 million[48] - Expected revenue for fiscal year 2024 is projected to be $350 million[48] - The company anticipates an early access launch of its first DNA data storage solution in late calendar 2023[23]

GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future AUGUST 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of manage ...

Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended June 30, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...

Twist Bioscience Corporation (NASDAQ:TWST) Q3 2022 Earnings Conference Call August 5, 2022 8:00 AM ET Company Participants Angela Bitting - Chief ESG Officer & SVP, Corporate Affairs Dr. Emily Leproust - Co-Founder, Chairman, President & CEO Jim Thorburn - CFO Conference Call Participants Matthew Sykes - Goldman Sachs Vijay Kumar - Evercore ISI Jake Putman - Barclays Puneet Souda - SVB Securities Max Smock - William Blair Catherine Schulte - Baird Steven Mah - Cowen Operator Welcome to the Twist Bioscience’ ...

G A G A G A L C T A ATCGATTS ICGAIA TGAGATCI W Fiscal 2022 3Q Financial Results AGATCTAG CGAT GATCOSTAGGTACAO ATGAGA TCATGAGATCCAGGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs; Chief ESG Officer Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking stat ...

| --- | --- | --- | --- | --- | |---------------------------------------------------------------------------------------------------------|-------|-------|-------|-------| | | | | | | | | | | | | | | | | | | | LOREM IPSUM | | | | | | DOLOR SIT AMET CONSECTETUR Twist Advances in NGS Applications Emily Leproust, PhD CEO and Co-Founder | | | | | | | | | | | 1 Legal Disclaimers This presentation contains forward-looking statements. In particular, statements regarding Twist Bioscience Corporation's ("Twist," "we ...