Workflow
Twist Bioscience(TWST)
icon
Search documents
Twist Bioscience(TWST) - 2022 Q2 - Earnings Call Presentation
2022-05-06 06:58
GAGAIICTA ATCGATTS ICGAIA TGAGATCI W BIOSCIENCE Fiscal 2022 2Q Financial Results AGATCTAG CGAT GATCC CTACACACATGAGA TCATGAGATCCGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking statements. All statements ...
Twist Bioscience(TWST) - 2022 Q2 - Quarterly Report
2022-05-05 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended March 31, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...
Twist Bioscience Corp (TWST) Investor Presentation - Slideshow
2022-03-07 18:26
GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future FEBRUARY 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of mana ...
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Presentation
2022-02-17 20:57
Fiscal 2022 1Q Financial Results AGATCTAGCGA TAGGTACAC T C A T G A G A T C A T G C T G A T G C T G Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | T W I S T B I O S C I E N C E Legal Disclaimers This presentation contains forward-looking statements. All statements other than statements of histo ...
Twist Bioscience(TWST) - 2022 Q1 - Quarterly Report
2022-02-08 16:00
Revenue Growth - Revenue increased by 49% to $42.0 million for the three months ended December 31, 2021, compared to $28.2 million for the same period in 2020[120]. - Synthetic gene revenue grew to $13.5 million, up from $9.7 million in the previous quarter, driven by an increase in the customer base and new product launches[106]. - Antibody discovery revenue rose to $4.8 million from $2.6 million in the previous quarter, attributed to growth from the recent Abveris acquisition[106]. - The Americas accounted for 54% of total revenues, while EMEA and APAC contributed 37% and 9%, respectively[116]. Expenses and Losses - Net loss attributable to common stockholders was $45.6 million for the three months ended December 31, 2021, compared to a net loss of $32.9 million for the same period in 2020[112]. - Research and development expenses increased by 62% to $22.6 million, up from $14.0 million in the same quarter of 2020, primarily due to increased headcount and outside services[122]. - Selling, general and administrative expenses increased to $51.1 million from $35.8 million in the previous quarter, driven by higher payroll and professional services costs[106]. - Selling, general and administrative expenses increased to $51.1 million in Q4 2021 from $28.8 million in Q4 2020, a 77% increase, primarily due to payroll expenses rising by $15.6 million[123]. Cash Flow and Investments - Net cash used in operating activities was $(46.7) million in Q4 2021, compared to $(24.9) million in Q4 2020, reflecting a worsening cash flow situation[139][140]. - Investing activities in Q4 2021 resulted in a net cash outflow of $(226.6) million, significantly higher than $(45.9) million in Q4 2020, indicating increased investment activity[141][142]. - Financing activities led to a net cash outflow of $(1.0) million in Q4 2021, contrasting sharply with a net inflow of $326.9 million in Q4 2020, highlighting a shift in financing strategy[143][144]. - As of December 31, 2021, the company had $191.6 million in cash and cash equivalents, $110.2 million in short-term investments, and $106.8 million in long-term investments, indicating a strong liquidity position[129]. - The company had $69.7 million in commitments for capital expenditures as of December 31, 2021, reflecting ongoing investment in growth initiatives[137]. Operational Expansion - The company shipped approximately 125,000 genes in the three months ended December 31, 2021, a 49% increase from approximately 84,000 genes in the same period of 2020[120]. - The company has expanded its manufacturing operations with a 12-year lease for approximately 111,000 square feet and an additional 101,000 square feet in the Portland area[109]. - The company entered into a 7-year operating lease for office space in South San Francisco, with total future minimum lease payments of $13.1 million, indicating expansion plans[148]. Tax and Interest - The income tax benefit recorded in Q4 2021 was $10.4 million, a significant increase from an expense of $(0.05) million in Q4 2020, representing a 227% change[126]. - Interest income rose to $0.2 million in Q4 2021, a 15% increase from $0.1 million in Q4 2020, while interest expense decreased by 78% to $(0.03) million[125]. Financial Position and Risks - The company had cash, cash equivalents, and marketable securities totaling $408.7 million as of December 31, 2021, down from $477.9 million as of September 30, 2021[164]. - The company is exposed to interest rate risk, with a hypothetical 10% relative change in interest rates not expected to materially impact financial statements[165]. - Foreign currency transactions primarily involve the Euro, Chinese Yuan, and British Pound, exposing the company to foreign exchange risk[166]. - The company does not use derivative financial instruments for speculative trading purposes, minimizing counterparty risk through creditworthy banks[167]. Goodwill and Intangible Assets - Goodwill is tested for impairment annually, with significant judgment required to assess fair value against carrying value[162]. - Intangible assets from business acquisitions include goodwill and development technology, with critical estimates based on projected revenues and discount rates[160]. Revenue Recognition - Biopharma revenue primarily consists of research and development agreements, with contract assets of $4.4 million and contract liabilities of $0.9 million as of December 31, 2021[157]. - Revenue is recognized based on the timing of development activities, with no revenue recognized from performance obligations satisfied in previous periods[157]. - The company recognizes revenue from functional license agreements when the license is transferred to the customer, allowing them to use and benefit from the license[156]. Stock-Based Compensation - Stock-based compensation includes performance-based stock units (PSUs) granted to executive officers and senior employees, with fair value calculated using the Black-Scholes method[159].
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Transcript
2022-02-04 19:45
Financial Data and Key Metrics Changes - The company reported record revenue of $42 million for Q1 2022, representing a sequential growth of 11% and a year-over-year growth of 49% [39] - Orders for the quarter were $49.6 million, a sequential increase of 10% and a year-over-year growth of 48% [39] - Gross margin for Q1 was 35.6%, slightly up from 35.5% in Q1 2021 [49] - The company ended the quarter with cash and investments of approximately $409 million [40] Business Line Data and Key Metrics Changes - SynBio revenue reached $18 million, up from $13.9 million in the same quarter of fiscal 2021, with orders at $22.2 million, a 40% increase year-over-year [46][43] - NGS revenue was $19.2 million, reflecting a 23% growth year-over-year, with orders at $21.8 million, a 28% increase year-over-year [45][41] - Biopharma revenue was approximately $4.8 million, including one month of contribution from the Abveris acquisition [46] Market Data and Key Metrics Changes - Healthcare revenue was $21 million, up from $16 million in Q1 2021; Industrial Chemicals revenue was $12.5 million, compared to $7.1 million in the same period [47] - EMEA region revenue was $15.4 million, significantly up from $9.1 million in Q1 2021, while APAC revenue reached $4 million, up from $1.8 million [48] Company Strategy and Development Direction - The company plans to continue expanding its customer base in synthetic biology and aims to bring the Factory of the Future online to reduce turnaround times and launch new products [61] - In NGS, the focus is on growing the market for liquid biopsy and MRD, with expectations of significant revenue expansion as these products reach commercialization [62] - The biopharma segment aims to leverage the integration of Abveris to enhance revenue through partnerships and internal pipeline advancements [63] Management's Comments on Operating Environment and Future Outlook - Management expressed optimism about the growth opportunities in NGS, particularly in liquid biopsy and MRD, despite short-term impacts from the Omicron variant [39][86] - The company anticipates a strong second half of fiscal 2022, driven by increased customer adoption and product launches [86] Other Important Information - The company has increased its revenue guidance for fiscal 2022 to a range of $189 million to $198 million, up from the previous guidance of $183 million to $193 million [54] - The gross margin guidance remains at 35% to 37%, reflecting ongoing costs associated with the Portland brand [56] Q&A Session Summary Question: Can you discuss the path forward for the Enzymatic Synthesis platform? - The company plans to develop its own hardware for Enzymatic Synthesis, particularly for enterprise data storage, while remaining open to partnerships for other markets [67][69] Question: What is the pricing variation for NGS products, especially for liquid biopsy? - Pricing varies based on the number of probes in a panel and the volume of samples ordered, with the company targeting to capture 5% to 10% of the liquid biopsy market [70][71] Question: What drove the strong growth in the EMEA region, and is it sustainable? - Growth in EMEA is attributed to investments in the commercial organization and strong demand across key countries, with expectations for continued growth [75] Question: Were the production challenges from the last quarter resolved? - Production issues were resolved, and the company shipped a record 125,000 genes, indicating strong demand in SynBio [82] Question: Why is the NGS guidance flat despite strong momentum? - The flat guidance reflects near-term conservatism, but the company expects significant growth in the second half of the year driven by customer adoption [86] Question: How has the nature of conversations in biopharma changed? - The company has gained a strong reputation, making it easier to engage with larger, more conservative companies compared to a few years ago [101]
Twist Bioscience(TWST) - 2021 Q4 - Annual Report
2021-11-22 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-K (Mark One) ☒ ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the fiscal year ended September 30, 2021 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-205888 (Sta ...
Twist Bioscience(TWST) - 2021 Q4 - Earnings Call Presentation
2021-11-22 14:20
l - W ● BIOSCIENCE . Fiscal 2021 4Q and Year-End Financial Results November 22, 2021 Agenda | --- | --- | --- | |----------------------------------------|-------|-------| | | | | | | | | | Welcome Angela Bitting | | | | SVP, Corporate Affairs | | | | Quarterly and Annual Highlights | | | | Emily Leproust | | | | Chief Executive Officer | | | | Financial and Operational Performance | | | | Jim Thorburn | | | | Chief Financial Officer | | | | Pipeline & Milestones | | | | Emily Leproust Chief Executive Office ...
Twist Bioscience(TWST) - 2021 Q3 - Earnings Call Presentation
2021-08-09 15:46
| W ● BIOSCIENCE . ● Fiscal 2021 3Q Financial Results August 6, 2021 Agenda | --- | --- | --- | |----------------------------------------|-------|-------| | | | | | | | | | Welcome Angela Bitting | | | | SVP, Corporate Affairs | | | | Quarterly Highlights | | | | Emily Leproust | | | | Chief Executive Officer | | | | Financial and Operational Performance | | | | Jim Thorburn | | | | Chief Financial Officer | | | | Pipeline & Milestones | | | | Emily Leproust Chief Executive Officer | | | Q&A Session 2 | TWI ...
Twist Bioscience(TWST) - 2021 Q3 - Quarterly Report
2021-08-08 16:00
[FORM 10-Q Filing Information](index=1&type=section&id=FORM%2010-Q) [Registrant Information](index=1&type=section&id=Registrant%20Information) Twist Bioscience Corporation, a Delaware-registered large accelerated filer, filed its Q2 2021 10-Q, listed on Nasdaq (TWST), having submitted all required reports - Company name: Twist Bioscience Corporation, registered in Delaware[2](index=2&type=chunk) - Stock ticker: **TWST**, listed on The Nasdaq Global Select Market[3](index=3&type=chunk) - Company type: Large accelerated filer, having submitted all required reports and interactive data files[3](index=3&type=chunk) Common Stock Outstanding | Date | Common Stock Outstanding (Shares) | | :--------- | :-------------------------------- | | August 5, 2021 | 49,292,036 | [Forward-Looking Statements](index=3&type=section&id=Forward-looking%20statements) [Nature of Forward-Looking Statements](index=3&type=section&id=Nature%20of%20Forward-Looking%20Statements) This 10-Q includes forward-looking statements on product development, market expansion, and COVID-19 antibody candidates, based on management's expectations and subject to risks that could cause material differences - Forward-looking statements cover matters such as product development, DNA data storage, market penetration, customer conversion, international market expansion, and the identification and development of COVID-19 antibody candidates[9](index=9&type=chunk) - Forward-looking statements are based on management's expectations as of the filing date and involve risks and uncertainties that could cause actual results, events, or circumstances to differ materially from those anticipated[9](index=9&type=chunk) [Risks and Uncertainties](index=3&type=section&id=Risks%20and%20Uncertainties) Forward-looking statements are subject to risks including revenue growth, financing, DNA production, market expansion, IP protection, competition, tech changes, acquisitions, IT security, talent, disasters, COVID-19, internal controls, and regulatory shifts - The company's ability to increase revenue and revenue growth rate[10](index=10&type=chunk) - The ability to accurately estimate capital requirements and additional financing needs[10](index=10&type=chunk) - The ability to increase DNA production, shorten turnaround times, and reduce costs for customers[10](index=10&type=chunk) - The ability to effectively manage the company's growth[10](index=10&type=chunk) - The ability to successfully enter new markets and manage international expansion[10](index=10&type=chunk) - The ability to protect intellectual property, including the proprietary DNA synthesis platform[10](index=10&type=chunk) - Costs associated with defending against intellectual property infringement and other claims[10](index=10&type=chunk) - The impact of increased competition in the business[10](index=10&type=chunk) - The ability to keep pace with technological and competitor changes[10](index=10&type=chunk) - The ability to successfully identify, evaluate, and manage future acquisitions of businesses, solutions, or technologies[10](index=10&type=chunk) - The success of marketing efforts[10](index=10&type=chunk) - Significant disruptions or security breaches in information technology systems and their resulting reputational impact[10](index=10&type=chunk) - The ability to attract and retain qualified employees and key personnel[10](index=10&type=chunk) - The impact of natural or man-made catastrophic events, including COVID-19[14](index=14&type=chunk) - The effectiveness of internal controls[14](index=14&type=chunk) - Changes in government regulations affecting the company's business[14](index=14&type=chunk) - Uncertainties in economic and market conditions and the impact of adverse economic conditions[14](index=14&type=chunk) - Other risk factors contained in the 'Risk Factors' section[14](index=14&type=chunk) [PART I. Financial Information](index=6&type=section&id=PART%20I.%20Financial%20information) [Item 1. Financial Statements](index=6&type=section&id=Item%201.%20Financial%20statements) This section presents Twist Bioscience Corporation's unaudited condensed consolidated financial statements for Q2 2021, including balance sheets, operations, equity, cash flows, and notes on accounting policies and performance [Condensed Consolidated Balance Sheets (Unaudited)](index=6&type=section&id=Condensed%20Consolidated%20Balance%20Sheets%20(unaudited)) Condensed Consolidated Balance Sheets (Unaudited) | (In thousands) | June 30, 2021 | September 30, 2020 | | :------------------------- | :------------ | :------------ | | **Assets** | | | | Cash and cash equivalents | $475,279 | $93,667 | | Short-term investments | $44,129 | $196,335 | | Accounts receivable, net | $28,116 | $26,376 | | Inventory | $21,224 | $12,289 | | Prepaid expenses and other current assets | $7,859 | $6,203 | | **Total current assets** | **$576,607** | **$334,870** | | Property and equipment, net | $37,864 | $25,466 | | Operating lease right-of-use assets | $62,803 | $33,699 | | Goodwill | $22,676 | $1,138 | | Intangible assets, net | $18,562 | $307 | | Restricted cash, non-current | $1,530 | $579 | | Other non-current assets | $5,256 | $2,823 | | **Total assets** | **$725,298** | **$398,882** | | **Liabilities and Stockholders' Equity** | | | | Accounts payable | $11,268 | $4,830 | | Accrued expenses | $4,867 | $3,901 | | Accrued compensation | $19,523 | $14,945 | | Current portion of operating lease liabilities | $7,545 | $6,409 | | Current portion of long-term debt | $2,365 | $3,333 | | Other current liabilities | $9,265 | $2,611 | | **Total current liabilities** | **$54,833** | **$36,029** | | Operating lease liabilities, net of current portion | $53,849 | $24,837 | | Long-term debt, net of current portion | — | $1,403 | | Other non-current liabilities | $6,168 | $351 | | **Total liabilities** | **$114,850** | **$62,620** | | **Stockholders' Equity** | | | | Additional paid-in capital | $1,179,331 | $794,630 | | Accumulated other comprehensive income | $428 | $87 | | Accumulated deficit | $(569,311) | $(458,455) | | **Total stockholders' equity** | **$610,448** | **$336,262** | | **Total liabilities and stockholders' equity** | **$725,298** | **$398,882** | [Condensed Consolidated Statements of Operations and Comprehensive Loss (Unaudited)](index=7&type=section&id=Condensed%20Consolidated%20Statements%20of%20Operations%20and%20Comprehensive%20Loss%20(unaudited)) Condensed Consolidated Statements of Operations and Comprehensive Loss (Unaudited) | (In thousands, except per share data) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------------------------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Revenue | $35,018 | $21,207 | $94,382 | $57,668 | | Operating expenses: | | | | | | Cost of revenue | $20,933 | $16,472 | $58,123 | $43,829 | | Research and development expenses | $19,838 | $10,444 | $49,629 | $31,369 | | Selling, general and administrative expenses | $34,478 | $22,487 | $97,658 | $76,082 | | Change in fair value of acquisition consideration | $1,887 | — | $1,887 | — | | Litigation settlement | — | — | — | $22,500 | | **Total operating expenses** | **$77,136** | **$49,403** | **$207,297** | **$173,780** | | Operating loss | $(42,118) | $(28,196) | $(112,915) | $(116,112) | | Interest income | $86 | $247 | $377 | $1,388 | | Interest expense | $(70) | $(181) | $(284) | $(644) | | Other income (expense), net | $(312) | $(56) | $(305) | $(125) | | Loss before income taxes | $(42,414) | $(28,186) | $(113,127) | $(115,493) | | Income tax benefit (expense) | $2,377 | $(21) | $2,271 | $(120) | | Net loss attributable to common stockholders | $(40,037) | $(28,207) | $(110,856) | $(115,613) | | Net loss per share—basic and diluted | $(0.82) | $(0.67) | $(2.32) | $(3.09) | | Weighted-average shares used in computing net loss per share | 48,963 | 41,838 | 47,881 | 37,463 | [Condensed Consolidated Statements of Stockholders' Equity (Unaudited)](index=8&type=section&id=Condensed%20Consolidated%20Statements%20of%20Stockholders'%20Equity%20(Unaudited)) Condensed Consolidated Statements of Stockholders' Equity (Unaudited) | (In thousands) | Shares | Amount | Additional paid-in capital | Other comprehensive income | Accumulated deficit | Total stockholders' equity | | :------------------------- | :------------ | :------------ | :---------------------------------------- | :---------------------------------------- | :----------------------------- | :-------------------------------------- | | **Balance as of March 31, 2021** | **48,860** | **$—** | **$1,143,265** | **$190** | **$(529,274)** | **$614,181** | | Adjustment for public offering costs | — | — | $(26) | — | — | $(26) | | Restricted stock unit vesting | 57 | — | — | — | — | — | | Stock option exercises | 132 | — | $2,619 | — | — | $2,619 | | Business acquisition | 237 | — | $26,773 | — | — | $26,773 | | Repurchase of common stock for tax withholding | (23) | — | $(2,476) | — | — | $(2,476) | | Stock-based compensation | — | — | $9,176 | — | — | $9,176 | | Other comprehensive income | — | — | — | $238 | — | $238 | | Net loss | — | — | — | — | $(40,037) | $(40,037) | | **Balance as of June 30, 2021** | **49,263** | **$—** | **$1,179,331** | **$428** | **$(569,311)** | **$610,448** | [Condensed Consolidated Statements of Cash Flows (Unaudited)](index=11&type=section&id=Condensed%20Consolidated%20Statements%20of%20Cash%20Flows%20(unaudited)) Condensed Consolidated Statements of Cash Flows (Unaudited) | (in thousands) | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------------------------------------------------ | :------------------ | :------------------ | | **Cash flows from operating activities** | | | | Net loss | $(110,856) | $(115,613) | | Adjustments to reconcile net loss to net cash used in operating activities: | | | | Depreciation and amortization | $7,319 | $4,788 | | Stock-based compensation | $27,751 | $11,965 | | Change in fair value of acquisition consideration | $1,887 | — | | Net change in operating assets and liabilities | $(5,435) | $(17,040) | | **Net cash used in operating activities** | **$(77,441)** | **$(117,053)** | | **Cash flows from investing activities** | | | | Purchases of property and equipment | $(18,972) | $(7,643) | | Business acquisition, net of cash acquired | $(483) | — | | Purchases of investments | $(58,795) | $(110,438) | | Proceeds from maturities of investments | $210,494 | $98,100 | | **Net cash provided by (used in) investing activities** | **$132,244** | **$(19,981)** | | **Cash flows from financing activities** | | | | Proceeds from stock option exercises | $11,686 | $4,977 | | Proceeds from public offerings, net of underwriting discounts, commissions, and offering costs | $323,861 | $295,807 | | Proceeds from issuance of common stock under employee stock purchase plan | $2,787 | $1,522 | | Repayment of debt | $(2,500) | $(2,500) | | Repurchase of common stock for tax withholding | $(8,227) | $(1,648) | | **Net cash provided by financing activities** | **$327,607** | **$298,158** | | Effect of exchange rate on cash, cash equivalents, and restricted cash | $153 | $(6) | | **Net increase in cash, cash equivalents, and restricted cash** | **$382,563** | **$161,118** | | Cash, cash equivalents, and restricted cash at beginning of period | $94,246 | $47,398 | | **Cash, cash equivalents, and restricted cash at end of period** | **$476,809** | **$208,516** | [Notes to Unaudited Condensed Consolidated Financial Statements](index=12&type=section&id=Notes%20to%20Unaudited%20Condensed%20Consolidated%20Financial%20Statements) [1. The Company](index=12&type=section&id=1.%20The%20Company) Twist Bioscience Corporation, founded in 2013, develops a disruptive DNA synthesis platform, has accumulated **$569.3 million** in deficits by June 2021, expects existing cash to fund operations for at least one year, with uncertain future COVID-19 impacts - Twist Bioscience Corporation, founded on February 4, 2013, focuses on synthetic biology and genomics, developing a disruptive DNA synthesis platform[25](index=25&type=chunk) - The company has incurred continuous losses since inception, with an accumulated deficit of **$569.3 million** as of June 30, 2021[26](index=26&type=chunk) - The company has raised **$1.0639 billion** in net proceeds from equity offerings and **$13.8 million** from debt, with management expecting existing funds to support operations for at least the next year[27](index=27&type=chunk) - The COVID-19 pandemic did not significantly impact financial results for the three and nine months ended June 30, 2021, but future effects remain unpredictable[29](index=29&type=chunk) [2. Summary of Significant Accounting Policies](index=12&type=section&id=2.%20Summary%20of%20significant%20accounting%20policies) This section outlines the basis and key accounting policies for the unaudited condensed consolidated financial statements, covering GAAP, estimates, and the assessment of recent ASUs (2016-13, 2017-04, 2019-12) that may affect future disclosures - Financial statements are prepared in accordance with U.S. Generally Accepted Accounting Principles (GAAP) and include normal and recurring adjustments deemed necessary by management[30](index=30&type=chunk) - The company is evaluating the impact of ASU 2016-13 (Financial Instruments—Credit Losses), ASU 2017-04 (Intangibles—Goodwill and Other), and ASU 2019-12 (Simplifying the Accounting for Income Taxes) on future financial statements and disclosures[35](index=35&type=chunk)[36](index=36&type=chunk)[37](index=37&type=chunk) Reconciliation of Cash, Cash Equivalents, and Restricted Cash | (in thousands) | June 30, 2021 | September 30, 2020 | | :--------------------------------- | :------------ | :------------ | | Cash and cash equivalents | $475,279 | $93,667 | | Restricted cash, non-current | $1,530 | $579 | | **Total cash, cash equivalents, and restricted cash** | **$476,809** | **$94,246** | [3. Fair Value Measurement](index=15&type=section&id=3.%20Fair%20value%20measurement) The company measures financial instruments at fair value under ASC 820 using a three-level input hierarchy, with short-term investments primarily using Level 2 inputs; as of June 30, 2021, total financial assets were **$519.4 million** and liabilities **$12.3 million**, mainly cash, money market funds, commercial paper, and U.S. treasury bills - The company uses ASC 820's fair value hierarchy, with short-term investments primarily utilizing Level 2 inputs (broker quotes in inactive markets)[38](index=38&type=chunk)[39](index=39&type=chunk) Fair Value of Financial Assets and Liabilities (June 30, 2021) | (in thousands) | Level 1 | Level 2 | Level 3 | Fair value | | :--------------------------------- | :--------- | :--------- | :------ | :--------- | | **Assets** | | | | | | Cash | $37,007 | $— | $— | $37,007 | | Money market funds | $438,272 | — | — | $438,272 | | Commercial paper | — | $7,998 | — | $7,998 | | U.S. government short-term treasury bills | $36,131 | — | — | $36,131 | | **Total financial assets** | **$511,410** | **$7,998** | **$—** | **$519,408** | | **Liabilities** | | | | | | Contingent consideration and indemnification holdback | $— | $12,278 | $— | $12,278 | | **Total financial liabilities** | **$—** | **$12,278** | **$—** | **$12,278** | [4. Balance Sheet Components](index=16&type=section&id=4.%20Balance%20sheet%20components) This section details the company's net accounts receivable and inventory composition; as of June 30, 2021, net accounts receivable totaled **$28.116 million** (trade: **$23.558 million**), and total inventory was **$21.224 million**, primarily raw materials Composition of Accounts Receivable, Net | (in thousands) | June 30, 2021 | September 30, 2020 | | :----------------------- | :------------ | :------------ | | Trade accounts receivable | $23,558 | $25,790 | | Other accounts receivable | $5,039 | $951 | | Allowance for doubtful accounts | $(481) | $(365) | | **Accounts receivable, net** | **$28,116** | **$26,376** | Composition of Inventory | (in thousands) | June 30, 2021 | September 30, 2020 | | :------------- | :------------ | :------------ | | Raw materials | $15,742 | $9,237 | | Work-in-process | $2,537 | $2,021 | | Finished goods | $2,945 | $1,031 | | **Total** | **$21,224** | **$12,289** | [5. Goodwill and Intangible Assets](index=16&type=section&id=5.%20Goodwill%20and%20intangible%20assets) As of June 30, 2021, goodwill and intangible assets increased by **$21.5 million** and **$18.4 million** respectively due to acquisitions; intangible assets, with a net book value of **$18.562 million**, primarily include developed technology, trade names, and customer relationships - For the three months ended June 30, 2021, goodwill and intangible assets increased by **$21.5 million** and **$18.4 million**, respectively, due to business acquisitions[45](index=45&type=chunk) Composition of Intangible Assets (June 30, 2021) | (in thousands, except for years) | Useful life (years) | Gross carrying amount (Thousands) | Accumulated amortization (Thousands) | Net book value (Thousands) | | :------------------------------- | :--------------- | :------------------------------- | :---------------------------------- | :-------------------------- | | Developed technology | 1.5 - 17 | $19,120 | $(1,068) | $18,052 | | Trade names and trademarks | 2 | $20 | $(20) | — | | Customer relationships | 1.5 | $510 | — | $510 | | **Total intangible assets** | | **$19,650** | **$(1,088)** | **$18,562** | [6. Commitments and Contingencies](index=17&type=section&id=6.%20Commitments%20and%20contingencies) The company faces litigation and has indemnification agreements; as of June 30, 2021, operating lease right-of-use assets were **$62.803 million**, with future minimum lease payments of **$134.125 million**; new facility leases were signed in late 2020 and early 2021 for expansion - The company may face litigation, claims, and disputes in its ordinary course of business and has entered into agreements with indemnification provisions, but has not incurred significant costs to date[48](index=48&type=chunk)[49](index=49&type=chunk) - As of June 30, 2021, operating lease right-of-use assets were **$62.803 million**, and net operating lease liabilities were **$53.849 million**[51](index=51&type=chunk) Future Minimum Operating Lease Payments (as of June 30, 2021) | (in thousands) | Operating Leases (Thousands) | | :------------------------- | :------- | | Remainder of 2021 | $1,390 | | 2022 | $8,909 | | 2023 | $10,552 | | 2024 | $10,293 | | 2025 | $10,445 | | Thereafter | $92,536 | | **Total minimum lease payments** | **$134,125** | | Less: Estimated interest | $(55,103) | | Less: Tenant improvement allowance | $(17,628) | | **Total operating lease liabilities** | **$61,394** | | Less: Current portion | $(7,545) | | **Operating lease liabilities, net of current portion** | **$53,849** | - The company entered into new facility lease agreements in December 2020 and April 2021 in Wilsonville, Oregon, and Brisbane, California, respectively, to expand operations, with total future minimum lease payments of **$27.9 million** and **$2.2 million**[54](index=54&type=chunk)[55](index=55&type=chunk)[57](index=57&type=chunk) [7. Related Party Transactions](index=20&type=section&id=7.%20Related%20party%20transactions) For the three and nine months ended June 30, 2021, the company purchased **$1.2 million** and **$3.5 million** in raw materials from related party investors, an increase from prior year periods Raw Material Purchases from Related Parties | (in millions) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Raw material purchases | $1.2 | $1.1 | $3.5 | $2.7 | [8. Income Taxes](index=20&type=section&id=8.%20Income%20taxes) For the three and nine months ended June 30, 2021, the company recorded income tax benefits of **$2.4 million** and **$2.3 million**, respectively, primarily due to deferred tax liabilities from a business acquisition Income Tax Benefit (Expense) | (in millions) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Income tax benefit | $2.4 | $(0.02) | $2.3 | $(0.12) | - The income tax benefit is primarily attributable to deferred tax liabilities assumed in a business acquisition[59](index=59&type=chunk) [9. Warrants](index=20&type=section&id=9.%20Warrants) The company issued 26,385 common stock warrants in 2015-2016; all were exercised by September 30, 2020, leaving no outstanding common stock warrants as of June 30, 2021 - As of September 30, 2020, the company had **26,385** warrants, all of which were net exercised in October and November 2020[60](index=60&type=chunk) - As of June 30, 2021, the company had no outstanding common stock warrants[60](index=60&type=chunk) [10. Common Stock](index=20&type=section&id=10.%20Common%20stock) The company raised capital through multiple public common stock offerings, including **$48 million** via ATM (2019-2020), **$140.2 million** and **$107.4 million** via underwritten offerings (Feb/June 2020), and **$323.9 million** via another underwritten offering (Dec 2020) Net Proceeds from Public Offerings of Common Stock | Offering Date/Period | Shares (Shares) | Price (Per Share) | Net Proceeds (Millions of USD) | | :----------------- | :--------- | :----------- | :----------------- | | December 2019-January 2020 | 2,239,680 | $22.32 | $48.0 | | February 2020 | 4,642,857 | $28.00 | $140.2 | | June 2020 | 3,484,848 | $33.00 | $107.4 | | December 2020 | 3,136,362 | $110.00 | $323.9 | [11. Stock-Based Compensation](index=22&type=section&id=11.%20Stock-based%20compensation) The company offers stock-based compensation via its 2018 Equity Incentive Plan, RSUs, and ESPP; as of June 30, 2021, **$76.2 million** in unrecognized costs are expected over 1.8-2.8 years, with a **$0.6 million** Q3 2021 increase from adjusted PSU estimates - The company provides stock-based compensation through its 2018 Equity Incentive Plan, Restricted Stock Units (RSUs), and 2018 Employee Stock Purchase Plan (ESPP)[65](index=65&type=chunk)[69](index=69&type=chunk)[71](index=71&type=chunk) - As of June 30, 2021, total unrecognized stock-based compensation costs were **$30.5 million** for stock options and **$45.7 million** for RSUs, expected to be recognized over 1.8 and 2.8 years, respectively[68](index=68&type=chunk)[70](index=70&type=chunk) - In the third quarter of 2021, the company adjusted performance stock unit (PSU) probability estimates, resulting in an approximate **$0.6 million** increase in stock-based compensation expense for the three and nine months ended June 30, 2021[66](index=66&type=chunk) Stock-Based Compensation Expense (by Category) | (in thousands) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :-------------------------- | :------------------ | :------------------ | :------------------ | :------------------ | | Cost of revenue | $773 | $279 | $1,990 | $890 | | Research and development expenses | $2,753 | $833 | $7,180 | $2,357 | | Selling, general and administrative expenses | $5,650 | $2,960 | $18,581 | $8,718 | | **Total stock-based compensation expense** | **$9,176** | **$4,072** | **$27,751** | **$11,965** | [12. Net Loss Per Share Attributable to Common Stockholders](index=24&type=section&id=12.%20Net%20loss%20per%20share%20attributable%20to%20common%20stockholders) For Q2 and YTD Q2 2021, basic and diluted net loss per share was **$0.82** and **$2.32**, respectively; potential dilutive common shares from options, RSUs, and ESPP were excluded due to their anti-dilutive effect Net Loss Per Share Attributable to Common Stockholders | (in thousands, except per share data) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------------------------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Net loss attributable to common stockholders | $(40,037) | $(28,207) | $(110,856) | $(115,613) | | Weighted-average shares used in computing net loss per share | 48,963 | 41,838 | 47,881 | 37,463 | | **Net loss per share—basic and diluted** | **$(0.82)** | **$(0.67)** | **$(2.32)** | **$(3.09)** | - Potential dilutive common shares from options, restricted stock units, and the employee stock purchase plan were excluded from diluted net loss per share calculations due to their anti-dilutive effect[74](index=74&type=chunk) [13. Geographic, Product, and Industry Information](index=25&type=section&id=13.%20Geographic%2C%20product%20and%20industry%20information) Company revenue is segmented by geography, product, and industry; for Q2 2021, the U.S. contributed **$18.72 million**, with EMEA and APAC also growing; NGS tools are key products, and healthcare is the largest revenue source, growing **102%** Revenue by Geographic Region | (in thousands) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------- | :------------------ | :------------------ | :------------------ | :------------------ | | United States | $18,720 | $13,365 | $53,831 | $34,944 | | EMEA | $12,658 | $6,394 | $31,694 | $18,566 | | APAC | $3,096 | $1,179 | $7,527 | $3,364 | | Americas | $544 | $269 | $1,330 | $794 | | **Total** | **$35,018** | **$21,207** | **$94,382** | **$57,668** | Revenue by Product | (in thousands) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Synthetic genes | $11,164 | $9,604 | $29,228 | $26,556 | | Oligo pools | $2,017 | $1,004 | $5,367 | $3,347 | | DNA and biopharma libraries | $3,140 | $1,522 | $8,567 | $3,933 | | NGS tools | $18,697 | $9,077 | $51,220 | $23,832 | | **Total** | **$35,018** | **$21,207** | **$94,382** | **$57,668** | Revenue by Industry | (in thousands) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------- | :------------------ | :------------------ | :------------------ | :------------------ | | Industrial chemicals | $9,422 | $7,698 | $25,214 | $21,471 | | Academic research | $7,748 | $4,624 | $18,297 | $14,341 | | Healthcare | $17,356 | $8,552 | $49,896 | $20,853 | | Agriculture | $492 | $333 | $975 | $1,003 | | **Total** | **$35,018** | **$21,207** | **$94,382** | **$57,668** | [14. Business Acquisition](index=26&type=section&id=14.%20Business%20acquisition) On June 14, 2021, the company acquired iGenomX for **$27.3 million** (cash and stock) to enhance NGS library prep, resulting in a **$21.5 million** goodwill increase, **$18.4 million** intangible asset increase, and a **$2.3 million** income tax benefit - On June 14, 2021, the company acquired iGenomX International Genomics Corporation to enhance multiplexed library preparation capabilities for NGS workflows[79](index=79&type=chunk) - The acquisition consideration was approximately **$27.3 million**, comprising **$0.5 million** in cash and **$26.8 million** in common stock, along with contingent consideration and indemnification holdback[80](index=80&type=chunk) - The acquisition resulted in a **$21.5 million** increase in goodwill, an **$18.4 million** increase in intangible assets, and a **$2.3 million** income tax benefit[84](index=84&type=chunk)[87](index=87&type=chunk) Fair Value of Assets Acquired and Liabilities Assumed in iGenomX Acquisition (June 14, 2021) | (in thousands) | June 14, 2021 | | :------------------------- | :------------ | | **Assets Acquired** | | | Cash and cash equivalents | $7 | | Accounts receivable | $37 | | Inventory | $14 | | Intangible assets | $18,410 | | Goodwill | $21,538 | | **Liabilities Assumed** | | | Accounts payable | $57 | | Accrued expenses | $44 | | Deferred tax liability | $2,252 | | **Fair value of assets acquired and liabilities assumed** | **$37,653** | | **Consideration Transferred** | | | Cash | $490 | | Company common stock | $26,772 | | Contingent consideration | $5,467 | | Indemnification holdback | $4,924 | | **Fair value of purchase consideration** | **$37,653** | [15. Subsequent Events](index=29&type=section&id=15.%20Subsequent%20events) On July 28, 2021, the company signed a 7-year operating lease for **21,195 square feet** of South San Francisco office space to expand operations, with total future minimum lease payments of **$13.1 million** - On July 28, 2021, the company entered into a 7-year operating lease agreement for **21,195 square feet** of office space in South San Francisco[90](index=90&type=chunk) - The total future minimum lease payments for this agreement amount to **$13.1 million**[90](index=90&type=chunk) [Item 2. Management's Discussion and Analysis of Financial Condition and Results of Operations](index=30&type=section&id=Item%202.%20Management's%20discussion%20and%20analysis%20of%20financial%20condition%20and%20results%20of%20operations) This section analyzes Twist Bioscience Corporation's financial condition and operating results for Q2 and YTD Q2 2021, detailing revenue, expenses, liquidity, capital, accounting policies, and COVID-19 impacts for the synthetic biology and genomics company facing continuous losses - The company is an innovative synthetic biology and genomics firm that developed a disruptive DNA synthesis platform, enabling the manufacturing of synthetic DNA by 'writing' DNA on silicon chips[94](index=94&type=chunk) - For the three and nine months ended June 30, 2021, the company reported revenues of **$35 million** and **$94.4 million**, respectively, but incurred net losses of **$40 million** and **$110.9 million** during the same periods[97](index=97&type=chunk)[104](index=104&type=chunk) - The company has established a scalable commercial platform, serving a diverse customer base across industrial chemicals, academic research, healthcare, food, agriculture, and data storage through direct sales, international distributors, and e-commerce platforms[99](index=99&type=chunk) [Overview](index=30&type=section&id=Overview) - The company developed a disruptive DNA synthesis platform to industrialize bioengineering by 'writing' DNA on silicon chips[94](index=94&type=chunk) - The company leverages its technology to manufacture synthetic genes, next-generation sequencing (NGS) sample preparation tools, and antibody libraries for drug discovery and development[94](index=94&type=chunk) - For the three months ended June 30, 2021, the company reported **$35 million** in revenue and a **$40 million** net loss, having continuously generated operating losses since inception[97](index=97&type=chunk) - The company serves over **2,200 customers** and achieves diversified customer reach through direct sales, international distributors, and e-commerce platforms[95](index=95&type=chunk)[99](index=99&type=chunk) [COVID-19 Considerations](index=32&type=section&id=COVID-19%20considerations) - For the three and nine months ended June 30, 2021, the company's revenue was not significantly impacted by the COVID-19 pandemic[101](index=101&type=chunk) - The company implemented measures such as increasing inventory, remote work, providing personal protective equipment, and paid sick leave to address the pandemic[102](index=102&type=chunk) - The future impact of the COVID-19 pandemic on financial performance and operations remains highly uncertain, potentially leading to decreased sales activities, customer orders, and impacts on supply chain and employee safety[101](index=101&type=chunk)[103](index=103&type=chunk) [Financial Overview](index=32&type=section&id=Financial%20overview) Summary of Key Financial Data | (in thousands) | Three Months Ended June 30, 2021 | Three Months Ended June 30, 2020 | Nine Months Ended June 30, 2021 | Nine Months Ended June 30, 2020 | | :------------------------------ | :------------------ | :------------------ | :------------------ | :------------------ | | Revenue | $35,018 | $21,207 | $94,382 | $57,668 | | Operating loss | $(42,118) | $(28,196) | $(112,915) | $(116,112) | | Net loss attributable to common stockholders | $(40,037) | $(28,207) | $(110,856) | $(115,613) | [Revenues](index=32&type=section&id=Revenues) - Company revenue primarily derives from the sales of synthetic genes, Oligo pools, NGS tools, and DNA libraries[106](index=106&type=chunk) - Revenue growth depends on the company's ability to penetrate domestic and international markets, new product launches, the sales capabilities of its direct sales team, and the role of its e-commerce platform[106](index=106&type=chunk) Revenue by Geographic Region (with Percentages) | (in thousands, except percentages) | Three Months Ended June 30, 2021 | % | Three Months Ended June 30, 2020 | % | Nine Months Ended June 30, 2021 | % | Nine Months Ended June 30, 2020 | % | | :--------------------------------- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | | United States | $18,720 | 53% | $13,365 | 63% | $53,831 | 57% | $34,944 | 61% | | EMEA | $12,658 | 36% | $6,394 | 30% | $31,694 | 34% | $18,566 | 32% | | APAC | $3,096 | 9% | $1,179 | 6% | $7,527 | 8% | $3,364 | 6% | | Americas | $544 | 2% | $269 | 1% | $1,330 | 1% | $794 | 1% | | **Total Revenue** | **$35,018** | 100% | **$21,207** | 100% | **$94,382** | 100% | **$57,668** | 100% | Revenue by Product (with Percentages) | (in thousands, except percentages) | Three Months Ended June 30, 2021 | % | Three Months Ended June 30, 2020 | % | Nine Months Ended June 30, 2021 | % | Nine Months Ended June 30, 2020 | % | | :--------------------------------- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | | Synthetic genes | $11,164 | 32% | $9,604 | 45% | $29,228 | 31% | $26,556 | 46% | | Oligo pools | $2,017 | 6% | $1,004 | 5% | $5,367 | 6% | $3,347 | 6% | | DNA and biopharma libraries | $3,140 | 9% | $1,522 | 7% | $8,567 | 9% | $3,933 | 7% | | NGS tools | $18,697 | 53% | $9,077 | 43% | $51,220 | 54% | $23,832 | 41% | | **Total Revenue** | **$35,018** | 100% | **$21,207** | 100% | **$94,382** | 100% | **$57,668** | 100% | Revenue by Industry (with Percentages) | (in thousands, except percentages) | Three Months Ended June 30, 2021 | % | Three Months Ended June 30, 2020 | % | Nine Months Ended June 30, 2021 | % | Nine Months Ended June 30, 2020 | % | | :--------------------------------- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | :------------------ | :-- | | Industrial chemicals | $9,422 | 27% | $7,698 | 36% | $25,214 | 27% | $21,471 | 37% | | Academic research | $7,748 | 22% | $4,624 | 22% | $18,297 | 19% | $14,341 | 25% | | Healthcare | $17,356 | 50% | $8,552 | 40% | $49,896 | 53% | $20,853 | 36% | | Agriculture | $492 | 1% | $333 | 2% | $975 | 1% | $1,003 | 2% | | **Total Revenue** | **$35,018** | 100% | **$21,207** | 100% | **$94,382** | 100% | **$57,668** | 100% | [Product Shipments (Including Synthetic Genes)](index=33&type=section&id=Product%20shipments%20including%20synthetic%20genes) Product Shipments and Gene Count | (in thousands, except shipments) | June 30, 2021 | March 31, 2021 | December 31, 2020 | September 30, 2020 | June 30, 2020 | March 31, 2020 | December 31, 2019 | September 30, 2019 | | :------------------------------- | :------------ | :------------ | :------------- | :------------- | :------------ | :------------ | :------------- | :------------- | | Gene Count (Thousands) | 107 | 90 | 84 | 87 | 83 | 89 | 80 | 80 | | Shipments (Thousands) | 13,810 | 10,981 | 9,313 | 8,292 | 7,213 | 6,595 | 6,154 | 5,631 | [Comparison of the Three Months Ended June 30, 2021 and 2020](index=35&type=section&id=Comparison%20of%20the%20three%20months%20ended%20June%2030%2C%202021%20and%202020) Revenue Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------- | :--------- | | Revenue | $35,018 | $21,207 | $13,811 | 65% | - Revenue growth was primarily driven by an expanded customer base, international business growth, and the introduction of new products, such as Clonal ready gene fragments launched in December 2020[114](index=114&type=chunk) - NGS tool revenue growth was mainly due to increased customer adoption, while DNA and biopharma revenue growth resulted from providing antibody discovery services to pharmaceutical companies[114](index=114&type=chunk) Cost of Revenue Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Cost of revenue | $20,933 | $16,472 | $4,461 | 27% | - Cost of revenue as a percentage of total revenue decreased from **78%** in Q3 2020 to **60%** in Q3 2021, primarily due to increased product shipments and changes in product mix[115](index=115&type=chunk) Research and Development Expense Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Research and development expenses | $19,838 | $10,444 | $9,394 | 90% | - Increased R&D expenses were primarily due to a **$4.7 million** rise in R&D personnel compensation and stock-based compensation, alongside a **$3.2 million** increase in external service costs related to data storage technology development[116](index=116&type=chunk) Selling, General and Administrative Expense Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------- | :--------- | | Selling, general and administrative expenses | $34,478 | $22,487 | $11,991 | 53% | - Increased SG&A expenses were primarily due to a **$7.9 million** rise in compensation and related costs from commercial organization investments (including **$2.7 million** in stock-based compensation), and a **$2.0 million** increase in professional services and audit fees[117](index=117&type=chunk) Change in Fair Value of Acquisition Consideration Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Change in fair value of acquisition consideration | $1,887 | $— | $1,887 | 100% | - A **$1.9 million** change in fair value of acquisition consideration was recognized in Q3 2021, related to contingent consideration and indemnification holdback from the iGenomX acquisition[118](index=118&type=chunk) Interest and Other Income (Expense), Net Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Interest income | $86 | $247 | $(161) | 65% | | Interest expense | $(70) | $(181) | $111 | 61% | | Other income (expense), net | $(312) | $(56) | $(256) | 457% | | **Interest and other income (expense), net** | **$(296)** | **$10** | **$(306)** | 3,060% | Income Tax Benefit (Expense) Comparison (Q3 2021 vs Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Income tax benefit (expense) | $2,377 | $(21) | $2,398 | 11,419% | - A **$2.4 million** income tax benefit was recorded in Q3 2021, primarily stemming from a business acquisition[120](index=120&type=chunk) [Comparison of the Nine Months Ended June 30, 2021 and 2020](index=37&type=section&id=Comparison%20of%20the%20nine%20months%20ended%20June%2030%2C%202021%20and%202020) Revenue Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------- | :--------- | | Revenue | $94,382 | $57,668 | $36,714 | 64% | - Revenue growth primarily reflects a **$4.6 million** increase in DNA and biopharma library revenue and a **$27.4 million** increase in NGS tool revenue[123](index=123&type=chunk) Cost of Revenue Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Cost of revenue | $58,123 | $43,829 | $14,294 | 33% | - Cost of revenue as a percentage of total revenue decreased from **76%** in YTD Q3 2020 to **62%** in YTD Q3 2021, primarily due to increased product shipments and changes in product mix[124](index=124&type=chunk) Research and Development Expense Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Research and development expenses | $49,629 | $31,369 | $18,260 | 58% | - Increased R&D expenses were primarily due to a **$13.1 million** rise in engineering employee compensation and stock-based compensation, alongside a **$5.2 million** increase in external service costs related to data storage technology development[125](index=125&type=chunk) Selling, General and Administrative Expense Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Selling, general and administrative expenses | $97,658 | $76,082 | $21,576 | 28% | - Increased SG&A expenses were primarily due to a **$24.2 million** rise in compensation and related costs from increased commercial organization personnel (including **$9.9 million** in stock-based compensation), partially offset by an **$11.5 million** reduction in legal fees related to the Agilent litigation settlement[126](index=126&type=chunk) Change in Fair Value of Acquisition Consideration Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Change in fair value of acquisition consideration | $1,887 | $— | $1,887 | 100% | - A **$1.9 million** change in fair value of acquisition consideration was recognized in YTD Q3 2021, related to contingent consideration and indemnification holdback from the iGenomX acquisition[127](index=127&type=chunk) Litigation Settlement Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Litigation settlement | $— | $22,500 | $22,500 | 100% | - On February 6, 2020, the company reached a settlement agreement with Agilent Technologies, Inc., paying **$22.5 million** to resolve all claims[128](index=128&type=chunk) Interest and Other Income (Expense), Net Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------- | :--------- | | Interest income | $377 | $1,388 | $(1,011) | 73% | | Interest expense | $(284) | $(644) | $360 | 56% | | Other income (expense), net | $(305) | $(125) | $(180) | 144% | | **Interest and other income (expense), net** | **$(212)** | **$619** | **$(831)** | 134% | Income Tax Benefit (Expense) Comparison (YTD Q3 2021 vs YTD Q3 2020) | (in thousands, except percentages) | June 30, 2021 | June 30, 2020 | Change (Thousands) | Change (%) | | :------------------------------- | :------------ | :------------ | :------ | :--------- | | Income tax benefit (expense) | $2,271 | $(120) | $2,391 | 1,993% | - A **$2.3 million** income tax benefit was recorded in YTD Q3 2021, primarily stemming from a business acquisition[130](index=130&type=chunk) [Liquidity and Capital Resources](index=40&type=section&id=Liquidity%20and%20capital%20resources) - The company primarily funds operations through public equity offerings, private placements of convertible preferred stock, credit facilities, and revenue from commercial operations[132](index=132&type=chunk) - As of June 30, 2021, the company held **$475.3 million** in cash and cash equivalents and **$44.1 million** in short-term investments[133](index=133&type=chunk) - The company has a loan and security agreement with Silicon Valley Bank, including a **$20 million** term loan and a **$10 million** revolving line of credit, with the revolving line of credit undrawn as of June 30, 2021[134](index=134&type=chunk)[136](index=136&type=chunk) - The company expects existing cash and cash equivalents to be sufficient to fund operating expenses, capital expenditures, and debt service for at least the next 12 months[197](index=197&type=chunk) Summary of Cash Flows (Nine Months) | (in thousands) | June 30, 2021 | June 30, 2020 | | :--------------------------------- | :------------ | :------------ | | Net cash used in operating activities | $(77,441) | $(117,053) | | Net cash provided by (used in) investing activities | $132,244 | $(19,981) | | Net cash provided by financing activities | $327,607 | $298,158 | - For YTD Q3 2021, cash outflow from operating activities was **$77.4 million**, cash inflow from investing activities was **$132.2 million**, and cash inflow from financing activities was **$327.6 million**[142](index=142&type=chunk)[144](index=144&type=chunk)[146](index=146&type=chunk) [Off-Balance Sheet Arrangements](index=44&type=section&id=Off-balance%20sheet%20arrangements) - The company has no off-balance sheet arrangements[148](index=148&type=chunk) [Contractual Obligations and Other Commitments](index=46&type=section&id=Contractual%20obligations%20and%20other%20commitments) - The company's contractual obligations have not materially changed since the annual report, but several new lease agreements have been added[150](index=150&type=chunk) - In December 2020, the company entered into a 12-year operating lease agreement for a facility in Wilsonville, Oregon, with total future minimum lease payments of **$27.9 million**[151](index=151&type=chunk) - In April 2021, the company amended the Wilsonville lease agreement, adding approximately **101,000 square feet** and extending the termination date to April 1, 2034, with additional rent estimated at **$17.6 million**[152](index=152&type=chunk) - In April 2021, the company entered into a 5-year operating lease agreement for a warehouse in Brisbane, California, with total future minimum lease payments of **$2.2 million**[153](index=153&type=chunk) [Critical Accounting Policies and Significant Management Estimates](index=46&type=section&id=Critical%20accounting%20policies%20and%20significant%20management%20estimates) - Critical accounting policies include revenue recognition, stock-based compensation, and business acquisitions, requiring significant management judgments and estimates in financial statement preparation[155](index=155&type=chunk)[156](index=156&type=chunk)[166](index=166&type=chunk)[168](index=168&type=chunk) - Revenue recognition is based on the transfer of control upon product delivery, while biopharma library revenue is recognized over time based on the progress of development activities[161](index=161&type=chunk)[162](index=162&type=chunk) - Stock-based compensation expense is measured at fair value on the grant date and recognized over the service period, with the fair value of performance stock units (PSUs) not considering vesting conditions[166](index=166&type=chunk)[167](index=167&type=chunk) - Business acquisitions are accounted for using the acquisition method, involving preliminary fair value estimates for acquired assets and liabilities, subject to adjustment during the measurement period[168](index=168&type=chunk) [Recently Issued Accounting Pronouncements](index=50&type=section&id=Recently%20issued%20accounting%20pronouncements) - The company has evaluated all recently issued Accounting Standards Updates (ASUs) and will detail their applicability and impact in Note 2[170](index=170&type=chunk) [Item 3. Quantitative and Qualitative Disclosures About Market Risk](index=50&type=section&id=Item%203.%20Quantitative%20and%20qualitative%20disclosures%20about%20market%20risk) This section discloses the company's market risks, primarily interest rate and foreign currency exchange rate risks; substantial cash and short-term investments are held, with minimal fair value impact from interest rate changes due to short-term nature; foreign exchange risk exists from non-USD international transactions, with no speculative or full hedging derivatives used - The company's primary market risks are interest rate risk and foreign currency exchange rate risk[171](index=171&type=chunk)[172](index=172&type=chunk) - As of June 30, 2021, the company held **$475.3 million** in cash and cash equivalents and **$44.1 million** in short-term investments[171](index=171&type=chunk) - Due to the short-term nature of the investment portfolio, a 100 basis point change in interest rates would not materially impact the fair value of the portfolio[171](index=171&type=chunk) - Most of the company's transactions are denominated in U.S. dollars, but some international transactions are denominated in non-U.S. currencies such as Euros, Renminbi, and British Pounds, exposing the company to foreign currency risk[172](index=172&type=chunk) - The company does not use derivative financial instruments for speculative purposes or to fully hedge foreign currency exchange rate risk[173](index=173&type=chunk) [Item 4. Controls and Procedures](index=52&type=section&id=Item%204.%20Controls%20and%20procedures) As of June 30, 2021, disclosure controls and procedures were ineffective due to material weaknesses in journal entry, revenue order entry, and IT general controls; the company implemented remediation, including strengthening governance, hiring a CAO, improving controls, and ongoing efforts to enhance effectiveness - As of June 30, 2021, the company's disclosure controls and procedures were deemed ineffective, primarily due to material weaknesses in internal control[174](index=174&type=chunk) - Material weaknesses included issues in journal entry processes, revenue order entry processes, and information technology general controls[176](index=176&type=chunk) - Strengthening corporate governance protocols and entity-level controls[178](index=178&type=chunk) - Hiring a Chief Accounting Officer with extensive experience[178](index=178&type=chunk) - Enhancing journal entry access and responsibility monitoring to ensure segregation of duties[179](index=179&type=chunk) - Strengthening the design and execution of order entry system application controls to enforce post-production sales order change workflows[179](index=179&type=chunk) - Reviewing the control environment and design, redesigning ITGC controls to align with the COBIT framework, and designing additional controls to address user access and change management risks[179](index=179&type=chunk) - The company is continuously undertaking remediation efforts, including analyzing SAP transaction codes to eliminate segregation of duties conflicts, improving review processes for customer order entry data edits, redesigning the segregation of duties framework for the revenue cycle, and implementing enhanced user access controls[180](index=180&type=chunk)[183](index=183&type=chunk) [PART II. Other Information](index=54&type=section&id=PART%20II.%20Other%20information) [Item 1. Legal Proceedings](index=54&type=section&id=Item%201.%20Legal%20proceedings) The company faces various legal proceedings and claims in its ordinary course of business, but management believes their ultimate resolution will not materially adversely affect the company's business, financial condition, operating results, or cash flows - The company faces various legal proceedings and claims in its ordinary course of business[185](index=185&type=chunk) - Management believes the ultimate resolution of these matters will not have a material adverse effect on the company's business, financial condition, results of operations, or cash flows[185](index=185&type=chunk) [Item 1A. Risk Factors](index=54&type=section&id=Item%201A.%20Risk%20factors) Investing in common stock involves high risks, including COVID-19, continuous losses, financing, growth management, tech competition, IP protection, supplier reliance, talent loss, acquisition, regulatory, internal control, international, tax, and market price volatility, which could cause actual results to differ materially from expectations - Investing in the company's common stock involves a high degree of risk, and investors should carefully consider all information[186](index=186&type=chunk) - COVID-19 related risks[186](index=186&type=chunk) - Continuous losses and potential inability to achieve profitability[194](index=194&type=chunk) - Need for additional financing to achieve objectives, otherwise potentially forced to delay or terminate operations[195](index=195&type=chunk) - Failure to maintain adequate revenue growth or successfully manage growth will harm business prospects[196](index=196&type=chunk) - Rapid changes and intense competition in synthetic biology technology may lead to product obsolescence or loss of competitiveness[200](index=200&type=chunk) - Business success is highly dependent on disruptive technology and market position as a leading supplier of silicon-chip-based synthetic DNA[201](index=201&type=chunk) - Reliance on a single key component supplier, whose loss or supply failure could cause delays in DNA synthesis processes[202](index=202&type=chunk) - Reliance on senior management and other key personnel, with loss of talent potentially harming product development[205](index=205&type=chunk) - Strategic transactions, including acquisitions, may disrupt business, dilute equity, or be unsuccessful[207](index=207&type=chunk) - Products may be subject to additional future regulation by the FDA or other domestic and international regulatory agencies, increasing costs and delaying commercialization[209](index=209&type=chunk) - Failure to maintain adequate and effective internal controls could impair the ability to timely provide accurate financial statements[210](index=210&type=chunk) - Uncertainty regarding the ability to protect intellectual property and proprietary technology[214](index=214&type=chunk) - Inability to obtain, maintain, and enforce intellectual property protection could lead to competitors manufacturing, using, or selling similar products[217](index=217&type=chunk) - Fluctuations in quarterly and annual operating results and cash flows, potentially leading to a significant decline in common stock value[218](index=218&type=chunk) - Failure to attract new customers and retain existing ones could materially adversely affect the business[219](index=219&type=chunk) - Information technology system disruptions or security breaches could adversely affect the business[222](index=222&type=chunk) - Actual operating results may differ materially from company guidance[223](index=223&type=chunk) - Inability to expand DNA synthesis manufacturing capacity could lead to lost revenue[225](index=225&type=chunk) - Heavy reliance on synthetic DNA products[226](index=226&type=chunk) - Inability to ensure adequate and stable supply of raw materials[227](index=227&type=chunk) - Difficulties in managing growth could impair profitability[229](index=229&type=chunk) - Loss of a few large customers could harm revenue, operating results, and reputation[231](index=231&type=chunk) - Restrictions in credit agreements may limit business operational flexibility[234](index=234&type=chunk) - International business operations pose operational and financial risks[235](index=235&type=chunk) - Ability to offset future taxable income with net operating loss carryforwards may be limited[237](index=237&type=chunk) - Changes in tax legislation or policy could affect future financial condition and operating results[239](index=239&type=chunk) - Failure to collect accounts receivable from a significant number of customers could adversely affect the business[241](index=241&type=chunk) - Failure to maintain adequate and effective internal controls could impair the ability to timely provide accurate financial statements[242](index=242&type=chunk) - Operating as a public company may consume significant resources and management attention[244](index=244&type=chunk) - Uncertainty regarding the ability to protect intellectual property and proprietary technology[246](index=246&type=chunk) - Inability to obtain, maintain, and enforce intellectual property protection could lead to competitors manufacturing, using, or selling similar products[248](index=248&type=chunk) - Inability to protect intellectual property globally[250](index=250&type=chunk) - Inability to protect the confidentiality of proprietary information and know-how could affect the value of technology and products[253](index=253&type=chunk) - May be involved in litigation to protect or enforce patents and proprietary rights, or to defend against third-party intellectual property infringement claims[254](index=254&type=chunk) - Failure to successfully acquire or maintain necessary rights for products and technologies through acquisitions and licenses[255](index=255&type=chunk) - Failure to register certain trademarks in all potential markets could adversely affect the business[256](index=256&type=chunk) - Reliance on licensed technology, where loss of rights could prevent product sales[259](index=259&type=chunk) - Never paid dividends and do not intend to pay them in the future[261](index=261&type=chunk) - Company charter and Delaware law may deter acquisitions that stockholders consider favorable[262](index=262&type=chunk) - Company bylaws designate the Delaware Court of Chancery and the U.S. federal district courts as exclusive forums[263](index=263&type=chunk) - Common stock market price may fluctuate or decline, resulting in significant investment losses[264](index=264&type=chunk) - Failure of securities or industry analysts to publish research or publishing negative reports could lead to a decline in stock price and trading volume[267](index=267&type=chunk) - Future sales and issuances of common stock or rights to purchase common stock may result in further dilution for stockholders[268](index=268&type=chunk) - Indemnification obligations for directors and officers may reduce funds available to the company[269](index=269&type=chunk) - Evolving expectations regarding corporate responsibility practices, particularly ESG matters, may expose the company to reputational and other risks[270](index=270&type=chunk) [Item 2. Unregistered Sales of Equity Securities and Use of Proceeds](index=102&type=section&id=Item%202.%20Unregistered%20sales%20of%20equity%20securities%20and%20use%20of%20proceeds) During the reporting period, the company had no unregistered sales of equity securities - During the reporting period, the company had no unregistered sales of equity securities[338](index=338&type=chunk) [Item 3. Defaults Upon Senior Securities](index=102&type=section&id=Item%203.%20Defaults%20upon%20senior%20securities) During the reporting period, the company had no defaults upon senior securities - During the reporting period, the company had no defaults upon senior securities[339](index=339&type=chunk) [Item 4. Mine Safety Disclosures](index=102&type=section&id=Item%204.%20Mine%20safety%20disclosures) This disclosure is not applicable to the company - Mine safety disclosures are not applicable to the company[340](index=340&type=chunk) [Item 5. Other Information](index=102&type=section&id=Item%205.%20Other%20information) During the reporting period, the company disclosed no other information - During the reporting period, the company disclosed no other information[341](index=341&type=chunk) [Item 6. Exhibits](index=103&type=section&id=Item%206.%20Exhibits) This section lists exhibits filed with the 10-Q report, including the registration rights agreement, CEO and CFO certifications under Sarbanes-Oxley Act Sections 302 and 906, and financial statements in iXBRL format - Registration Rights Agreement (Exhibit 4.1)[343](index=343&type=chunk) - Certifications of Chief Executive Officer and Chief Financial Officer pursuant to Section 302 of the Sarbanes-Oxley Act (Exhibits 31.1, 31.2)[343](index=343&type=chunk) - Certifications of Chief Executive Officer and Chief Financial Officer pursuant to 18 U.S.C. Section 1350 (Sarbanes-Oxley Act Section 906) (Exhibits 32.1, 32.2)[343](index=343&type=chunk) - Condensed Consolidated Financial Statements and Notes thereto in iXBRL format (Exhibit 101)[343](index=343&type=chunk) - Inline XBRL Document – The cover page from the Company’s Quarterly Report on Form 10-Q (Exhibit 104)[343](index=343&type=chunk)